View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9385_high_2 (Length: 308)

Name: NF9385_high_2
Description: NF9385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9385_high_2
NF9385_high_2
[»] chr2 (1 HSPs)
chr2 (139-242)||(18156323-18156426)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 18156323 - 18156426
Alignment:
139 gaagaagatggtgtgattaatgatggtttcatgaaaatgagtaagtggaaattcatggtggtttgatgattctggttgaaggagatctatgaactatgaa 238  Q
    |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
18156323 gaagaagatggtgtgattgatgatggtttcatgaaaatgagtaagcggaaattcatggcggtttgatgattctggttgaaggagatctatgaactatgaa 18156422  T
239 gtaa 242  Q
    ||||    
18156423 gtaa 18156426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University