View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9385_low_3 (Length: 308)
Name: NF9385_low_3
Description: NF9385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9385_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 18156323 - 18156426
Alignment:
| Q |
139 |
gaagaagatggtgtgattaatgatggtttcatgaaaatgagtaagtggaaattcatggtggtttgatgattctggttgaaggagatctatgaactatgaa |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18156323 |
gaagaagatggtgtgattgatgatggtttcatgaaaatgagtaagcggaaattcatggcggtttgatgattctggttgaaggagatctatgaactatgaa |
18156422 |
T |
 |
| Q |
239 |
gtaa |
242 |
Q |
| |
|
|||| |
|
|
| T |
18156423 |
gtaa |
18156426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University