View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9385_low_6 (Length: 286)
Name: NF9385_low_6
Description: NF9385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9385_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 92 - 270
Target Start/End: Original strand, 31531941 - 31532119
Alignment:
| Q |
92 |
gaactgaaccaacttaatatgaatcacattaccaacatcttcttcaatttactggttctgcatatatgtttttgcaatttcagtcgaaaacagcaataca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
31531941 |
gaactgaaccaacttaatatgaatcacagtaccaacatcgtcttcaatttaatggttctgcatatatgtttttgcaatttcagttgaaaacaacaataca |
31532040 |
T |
 |
| Q |
192 |
tatatctaatttacggaggcatgccttaataaaatccgaaagagaaaggaaaagattatctttgacaaattgttgaact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
31532041 |
tatatctaatttacggaggcatgccttaattaaatccgaaagagaaaggaaaacattatcgttgacaaattgttgaact |
31532119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 31531819 - 31531921
Alignment:
| Q |
1 |
tcgagtttcgtggttagggatggacaaagttcagtttagacccaaaattgtgtctgaaccaaaccgaactgaactgtttttcggttcgtttgaactgaac |
100 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31531819 |
tcgagtatcttggttagggatgggcaaagttcaatttagactcaaaattgtgtctgaaccgaaccgaactgaactgtttttcagttcgtttgaactgaac |
31531918 |
T |
 |
| Q |
101 |
caa |
103 |
Q |
| |
|
||| |
|
|
| T |
31531919 |
caa |
31531921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 2380392 - 2380346
Alignment:
| Q |
18 |
ggatggacaaagttcagtttagacccaaaattgtgtctgaaccaaac |
64 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
2380392 |
ggatgggcaaagttcagttcagatccaaaattgagtctgaaccaaac |
2380346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University