View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9386_low_12 (Length: 344)
Name: NF9386_low_12
Description: NF9386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9386_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 29137426 - 29137763
Alignment:
| Q |
1 |
cgcaccaattttcctcgtggaccttcaacctcgatgagtttggcatggattttgatgcttactccgtcgggaatgtccattgtttcggaagagaggatgg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137426 |
cgcaccaatttgcctcgtggaccttcaacctcgatgagtttggcatggattttgatgcttactccgtcgggaatgtccattgtttcggaagagaggatgg |
29137525 |
T |
 |
| Q |
101 |
ttttcatcttgctctctctcgccgccggcgggaatgcagaggtgaagctttctgcgtgggtgaatagggttttaggattaggggtttagaaaagaggggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137526 |
ttttcatcttgctctctctcgccgccggcgggaatgcagaggtgaagctttctgcgtgggtgaatagggttttaggattaggggtttagaaaagaggggt |
29137625 |
T |
 |
| Q |
201 |
ttatatatgattgagagtgaaataattgttattgggtcactctaatcgg-----atcttagatatgttgtgtatgaaagaagtaggagattattgttcac |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137626 |
ttatatatgattgagagtgaaataattgttgttgggtcactctaatcgggtcttagcttagatatgttgtgtatgaaagaagtaggagattattgttcac |
29137725 |
T |
 |
| Q |
296 |
aaacccttgaaattatacacccctttttatgtgagtat |
333 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29137726 |
aaacccttgaaattatacacccctttttctgtgagtat |
29137763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University