View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9386_low_15 (Length: 265)
Name: NF9386_low_15
Description: NF9386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9386_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 262
Target Start/End: Original strand, 6821488 - 6821742
Alignment:
| Q |
8 |
ctagtattgaaacagacgnnnnnnngttagaactaaaaaagttagaaaattttgcaaagaaggtagtgggaaaatgtgggggattgccattagcaatcat |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6821488 |
ctagtattgaaacagacgtaaaaaagttagaactaaaaaagttagaaaattttgcaaagaaggtagtgggaaaatgtgggggattgatattagcaatcat |
6821587 |
T |
|
| Q |
108 |
atctcttgggtttgtcatgtcagcaaaagacgtaacccaagacagcttatcgtgggtgtttgaacaactcaatcatggccgttacaaaacgcattggctg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821588 |
atctcttgggtttgtcatgtcagcaaaagacgtaacccaagacagcttatcgtgggtgtttcaacaactcaatcatggccgttacaaaacgcattggctg |
6821687 |
T |
|
| Q |
208 |
caagcttggaaaaataacaaggatgaaatgagtgaaactgtgaggaactgtctct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821688 |
caagcttggaaaaataacaaggatgaaatgagtgaaactgtgaggaactgtctct |
6821742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 52 - 131
Target Start/End: Original strand, 7333838 - 7333917
Alignment:
| Q |
52 |
gaaaattttgcaaagaaggtagtgggaaaatgtgggggattgccattagcaatcatatctcttgggtttgtcatgtcagc |
131 |
Q |
| |
|
|||| ||| ||||| ||| ||||||||||||||||||| || ||||| || ||| |||||||||||| |||||| ||||| |
|
|
| T |
7333838 |
gaaagtttagcaaaaaagttagtgggaaaatgtgggggcttaccattggccatcttatctcttgggtgtgtcatatcagc |
7333917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University