View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9386_low_24 (Length: 201)
Name: NF9386_low_24
Description: NF9386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9386_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 16962997 - 16963178
Alignment:
| Q |
1 |
taatatgaaatgaaaaatatgatctaaatttaacttgtgcactag--tatgaaatgtttatatgtatgtaattatggccttacttgcataaatatttagt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16962997 |
taatatgaaatgaaaaatatgatctaaatttaacttgtgcactacaatatgaaatgtttatgtgtatgtaattatggccttacttgcataaatatttagt |
16963096 |
T |
 |
| Q |
99 |
cttgattctcttgaaatatcaacagatctatcttctctttctgctttagactttctcaaaatgaacagaaagagtagaatca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16963097 |
cttgattctcttgaaatatcaacagatctatcttctctttctgctttggactttctcaaaatgaacagaaagagtagaatca |
16963178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 68 - 180
Target Start/End: Original strand, 16215792 - 16215919
Alignment:
| Q |
68 |
aattatggccttacttgcataaatatttagtcttgattctcttgaaatatcaacagatctat---------------cttctctttctgctttagacttt |
152 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16215792 |
aattgtggccttacttgcataaatatttggtcttgattctcttgaaatatcaacagatctatgatctattttactatcttctctttctgctttagacttt |
16215891 |
T |
 |
| Q |
153 |
ctcaaaatgaacagaaagagtagaatca |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16215892 |
ctcaaaatgaacagaaagagtagaatca |
16215919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University