View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9387_low_18 (Length: 266)
Name: NF9387_low_18
Description: NF9387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9387_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 82 - 251
Target Start/End: Original strand, 31016120 - 31016289
Alignment:
| Q |
82 |
tccttccttcgagtcaaatagtcttagtctagtacgtgaatcccacacattaagtgtcgagaagtgaagaattatatgttcgaacttatctttgacacag |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| || |
|
|
| T |
31016120 |
tccttccttcgagtcaaatagtcttagtctagtacgtgaatcccacacattaagtgtcgagaagtggagaattatatgttcgaacttatgtttgacagag |
31016219 |
T |
 |
| Q |
182 |
atatcacattaatcgctttaaaacacaaaacattacttgccaaattattaataagaaatacattgcacct |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31016220 |
atatcacattagtcgctttaaaacacaaaacattacttgccaaattattaatgagaaatacattgcacct |
31016289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 71
Target Start/End: Original strand, 31016038 - 31016102
Alignment:
| Q |
7 |
ccttaattcaatacatattgaaacgagaaaccnnnnnnntaaatatatgttttggccggtttgtc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
31016038 |
ccttaattcaatacatattgaaacgagaaaccaacaaaataaatatatgttttggctggtttgtc |
31016102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University