View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9387_low_7 (Length: 339)
Name: NF9387_low_7
Description: NF9387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9387_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 99 - 329
Target Start/End: Original strand, 19700495 - 19700725
Alignment:
| Q |
99 |
atagtacattgaaacttagatgctacattgattagatccaagcttttgaacaaacccattactcattctaacccagaaaaagggtcatgggtggtagtag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19700495 |
atagtacattgaaacttagatgctacattgattagatccaagcttttgaacaaacccattactcattctaacccagaaaaagggtcatgggtggtagtag |
19700594 |
T |
|
| Q |
199 |
tattacagattcatggtgtttttgtaaaggtgtaagtaaaactgagagaatgaaaggtgctattttttcaggtaaaaaccaagctatggctactattact |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19700595 |
tattacagattcatggtgtttttgtaaaggtgtaagtaaaactgagagaatgaaaggtgctattttttcaggtaaaaaccaagctatggctactattact |
19700694 |
T |
|
| Q |
299 |
actaacaccaatgttggtaatggtgtctctg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19700695 |
actaacaccaatgttggtaatggtgtctctg |
19700725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University