View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_105 (Length: 293)
Name: NF9388A_low_105
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_105 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 24244961 - 24245241
Alignment:
| Q |
1 |
gcatgaagcaaatggaacacgagaaagcgcctatctcagatgcaagatcaatagaggaaactggaatacctatgacaacattgtcattatcctcgcgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
24244961 |
gcatgaagcaaatggaacacgagaaagcgcctatctcagatgcaagatcaatagaggaaactggaatacctatgacaacattgtcactttcctcgcgcaa |
24245060 |
T |
|
| Q |
101 |
aaattctgtttgtcgtttttcttcgaaggaaaagagtgttggagcgtcgaatgagtccgcgaagaaactttctttactaatagttttctatgctattgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24245061 |
aaattctgtttgtcgtttttcttcgaaggaaaagagtgttggagcgtcgaatgagtccgcgaagaaactttctttactaatagttttctatgctattgtt |
24245160 |
T |
|
| Q |
201 |
atgattgttgaatttgttgggggtttgaaagctcacagcttatctgttatcagtgatgctgcacatttgctttctgatatt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24245161 |
atgattgttgaatttgttgggggtttgaaagctcacagcttatctgttattagtgatgctgcacatttgctttctgatatt |
24245241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University