View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_136 (Length: 270)
Name: NF9388A_low_136
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_136 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 264
Target Start/End: Original strand, 36109742 - 36109997
Alignment:
| Q |
9 |
accatagaccattctcccccttttttgtagtttagaatttaagacctcaccttccatactttctggagataattatatcaatttgctaactaatccaagg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||| ||||||| |
|
|
| T |
36109742 |
accatagaccattctcccccttttttgtagtttagaatttaagacctcaccttccatactttctggaaataattatatcaatctggtaactagtccaagg |
36109841 |
T |
 |
| Q |
109 |
gcctggcttgtaaaatttcaaaggattacttacagctggtacaagtttttcttttatgtaccttggtggcattcattagcaatttagcatatactttaca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36109842 |
gcctggcttgtaaaatttcaaaggattacttacagctggtacaagtttttcttttatctaccttggtggcattcattagcaatttagcatatactttaca |
36109941 |
T |
 |
| Q |
209 |
tcatcataagcatcattggactcttgtgatgagcttcatcttgtaactgaggtatc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36109942 |
tcatcataagcatcattggactcttgtgatgagcttcatcttgcaactgaggtatc |
36109997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University