View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_142 (Length: 266)
Name: NF9388A_low_142
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_142 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 30 - 213
Target Start/End: Original strand, 2003362 - 2003547
Alignment:
| Q |
30 |
aaccgatcaccccacttatttaccttaaaaaggataattcctaactaatatgctacttgacnnnnnnnnnnnnnn--ctctgattttcttcttccatcat |
127 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2003362 |
aaccgatcaccccacttatctaccttaaaaaggataatttctaactaatatgctacttgacaaaaaaaaaaaaaaaactctgattttcttcttccatcat |
2003461 |
T |
 |
| Q |
128 |
atttttgtatttaaaatggttatttgatatcttttaagacgaatatacaacctaatgatatagagtgatcaatactcatgaattca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2003462 |
atttttgtatttaaaatggttatttgatatcttttaagacgaatatacaacctaatgctgtagagtgatcaatactcatgaattca |
2003547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University