View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_151 (Length: 259)
Name: NF9388A_low_151
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_151 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 90 - 259
Target Start/End: Original strand, 2956863 - 2957036
Alignment:
| Q |
90 |
gcagaattaatgatgaagtcgttgagttttattttgcagcgcgagttcagatccactaaagtctcccattcccattgttggtttttcttatg----tggt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2956863 |
gcagaattaatgatgaagtcgttgagttttattttgcagcgcgagttcaggtccactaaagtctcccattcccattgttggttgttcttatgtggttggt |
2956962 |
T |
 |
| Q |
186 |
ttcatcacaagcaaccaaagctatggttgcaagttgtactcattttttgcctcttccctccaacgtacctcctc |
259 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2956963 |
ttcctcacaagcaaccaaagctatggttgcaagttgtactcattttttgcctcttccctccaacgtacctcctc |
2957036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University