View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_177 (Length: 249)
Name: NF9388A_low_177
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_177 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 9813576 - 9813396
Alignment:
| Q |
17 |
ctttattctctacatataacccaagaccaagccatgaatctatcatggcattttgattattgcagcaatgcttgtttttggttcatttttcttaggtcgt |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9813576 |
ctttcttctctacatataacccaagaccaagccatgaatctatcatggcattttgattattgcagcaatgcttgtttttggttcatttttcttaggtcgt |
9813477 |
T |
 |
| Q |
117 |
gtttcaccccttataattccgctgcttttggtttttcccgttcttctggtagggcttatcatttttcttgactatagtctc |
197 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9813476 |
gtttcaccccatataattctgctgcttttggtttttcccgttcttctggtagggcttatcatttttcttgactatattctc |
9813396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 59
Target Start/End: Original strand, 49060402 - 49060436
Alignment:
| Q |
25 |
tctacatataacccaagaccaagccatgaatctat |
59 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49060402 |
tctacatataaaccaagaccaagccatgaatctat |
49060436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University