View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_182 (Length: 248)
Name: NF9388A_low_182
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_182 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 131 - 226
Target Start/End: Complemental strand, 2694353 - 2694258
Alignment:
| Q |
131 |
tgttattttcaatctacattttctctccttcaccagaaaacaagatcagtagcaacactctctaaacacaggatcaatgctgcttccccatttgtt |
226 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||| |||||||||| ||||| |
|
|
| T |
2694353 |
tgttatttccaatctacattttctctccttcaccagaagacaagatcagtagcaacactctctaaacacagaatctatgttgcttccccacttgtt |
2694258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 238
Target Start/End: Complemental strand, 2687290 - 2687228
Alignment:
| Q |
176 |
tcagtagcaacactctctaaacacaggatcaatgctgcttccccatttgttgatgtccatctc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| || ||| ||| |||||| |
|
|
| T |
2687290 |
tcagtagcaacactctctaaacacaggatcaatgttgcttccccacttcttgttgtacatctc |
2687228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 60
Target Start/End: Complemental strand, 2694445 - 2694408
Alignment:
| Q |
23 |
aaatcaaacatatggacatagattccagatattattta |
60 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
2694445 |
aaattaaacatatggacatagattcctgatattattta |
2694408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University