View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_183 (Length: 248)
Name: NF9388A_low_183
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_183 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 2003360 - 2003547
Alignment:
| Q |
13 |
tgaaccgatcaccccacttatttaccttaaaaaggataattcctaactaatatgctacttgacnnnnnnnnnnn-----ctctgattttcttcttccatc |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2003360 |
tgaaccgatcaccccacttatctaccttaaaaaggataatttctaactaatatgctacttgacaaaaaaaaaaaaaaaactctgattttcttcttccatc |
2003459 |
T |
 |
| Q |
108 |
atatttttgtatttaaaatggttatttgatatcttttaagacgaatatacaacctaatgatatagagtgatcaatactcatgaattca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2003460 |
atatttttgtatttaaaatggttatttgatatcttttaagacgaatatacaacctaatgctgtagagtgatcaatactcatgaattca |
2003547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University