View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_187 (Length: 248)
Name: NF9388A_low_187
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_187 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 33114655 - 33114423
Alignment:
| Q |
9 |
atatacacacataaacttcacccatctgtcgttcttggaagtttgaaccttgaagcttaatttgtttgaactttgaagtttcaattgnnnnnnnnntact |
108 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33114655 |
atatacacacagaaacttcacccatctgccgttcttggaagtttgaaccttgaagcttaatttgtttgaactttgaagtttcaattgaaaaaaaa-tact |
33114557 |
T |
|
| Q |
109 |
ggtcttctggaattatatataactcagtcctttcatgtgtcagtacaaaacaccacctcgttcatgtcaaagaaataaaagaccggtagttggtccggac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33114556 |
ggtcttctggaattatatataactcagtcctttcatgtgtcagtacaaaacaccacctcgttcatgtcaaagaaataaaagaccggtagttggtccggac |
33114457 |
T |
|
| Q |
209 |
tccatagctgctgtgagtgtacttacgttacgtt |
242 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
33114456 |
tacatagctgctgtgagtgtacttacgttacgtt |
33114423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University