View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_188 (Length: 248)
Name: NF9388A_low_188
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_188 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 7 - 143
Target Start/End: Complemental strand, 30965799 - 30965663
Alignment:
| Q |
7 |
gacatcatgaaacgttaattctttcatattcatgcaaacagtaaaatatttgtgacatgaaaaaagtgaaagtggtcaacatgataaaatagtcttgcta |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30965799 |
gacatcatgaaacattaattctttcatattcatgcaaacagtaaaatatttgtgacatgaaaaaagtgaaagtggtcaacatgataaaatagtcttgtta |
30965700 |
T |
|
| Q |
107 |
attaacatagaaaaattgattcagactctcactctgt |
143 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30965699 |
attaacatagaaaaatggattcagactctcactctgt |
30965663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University