View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_199 (Length: 246)
Name: NF9388A_low_199
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_199 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 22 - 246
Target Start/End: Complemental strand, 3272419 - 3272191
Alignment:
| Q |
22 |
aaaacagaatgtaaaactcccttcaaagaaaatgctttcttttgaacaatctatctaaccacattgcttgtgaaattgctgttatatgatgtaaaaaaca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272419 |
aaaacagaatgtaaaactcccttcaaagaaaatggtttcttttgaacaatctatctaaccacattgcttgtgaaattgctgttatatgatgtaaaaaaca |
3272320 |
T |
 |
| Q |
122 |
tgaaaccacactgtttgtc----nnnnnnnnnnntttgtgttaaccctccggtttttagggaaagaggccctagcaatccggttcggttagaaggtaaat |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272319 |
tgaaaccacactgtttgtcaaaaaaaaaaaaaaaattgtgttaaccctccggtttttaggggaagaggccctagcaatccggttcggttagaaggtaaat |
3272220 |
T |
 |
| Q |
218 |
aaagtctgaccaataattatttttactag |
246 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
3272219 |
aaagtctgaccaataattatttctactag |
3272191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University