View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_201 (Length: 246)
Name: NF9388A_low_201
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_201 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 1515464 - 1515317
Alignment:
| Q |
1 |
gaactctacatattgacgcatcaagtttatattgtatatatttatgattttaattttcaaaacccaaattacattagaaaggttaatcaaaaatcacttt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1515464 |
gaactctacatattgatgcatcaagtttatattgtatatatttatgattttaattttcaaaacccaaattacattagaaaggttaatcaaaaatcaattt |
1515365 |
T |
|
| Q |
101 |
tattttctaaaacattatttacatgagtaaaaaattcattttcttagg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1515364 |
tattttctaaaacattatttacatgagtcaaaaattcattttcttagg |
1515317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University