View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_206 (Length: 244)
Name: NF9388A_low_206
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_206 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 37 - 225
Target Start/End: Original strand, 1515507 - 1515698
Alignment:
| Q |
37 |
tagcttgtaaattcatatgaccaaaaaatatacttgtttgagacgttagcattatttctcatggactcataa---ttaacnnnnnnnnnnnnnatgagta |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
1515507 |
tagcttgtaaattcatatgaccaaaaaatatacttgtttgatacgttagcattatttctcatggactcataacttttatttttttatttttttatgagta |
1515606 |
T |
|
| Q |
134 |
gttacttcaagttgctcattgcttcaattcactcaatctacacatgttatcttaattgnnnnnnnnttaaatattaattagacatatttttt |
225 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1515607 |
gttacttcaagtagctcattgcttcaattcactcaatctacacatgttatcttaattgaaaaaaaattaaatattaattagacatatttttt |
1515698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University