View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_208 (Length: 244)
Name: NF9388A_low_208
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_208 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 24 - 165
Target Start/End: Original strand, 12045067 - 12045208
Alignment:
| Q |
24 |
tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12045067 |
tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac |
12045166 |
T |
 |
| Q |
124 |
aacatttgttctattaatttttattttggtgatatttgtcca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12045167 |
aacatttgttctattaatttttattttggcgatatttgtcca |
12045208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 229
Target Start/End: Original strand, 12045207 - 12045242
Alignment:
| Q |
194 |
cactgttcctccctctcatctcatgtgcttcatctc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12045207 |
cactgttcctccctctcatctcatgtgcttcttctc |
12045242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University