View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_216 (Length: 243)
Name: NF9388A_low_216
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_216 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 22 - 234
Target Start/End: Original strand, 7752747 - 7752959
Alignment:
| Q |
22 |
ttgtccacctcgactttagcttggacagtctcactggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctccgggaacag |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7752747 |
ttgttcacctcgactttagcttggacagtctcacaggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctctgggaacag |
7752846 |
T |
|
| Q |
122 |
gtttaccggccaaatccctgcatcactaggtcgactcactaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctcctta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752847 |
gtttaccggccaaatccctgcatcactaggtcgactcaccaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctcctta |
7752946 |
T |
|
| Q |
222 |
ggcatgatcaaga |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7752947 |
ggcatgatcaaga |
7752959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University