View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_223 (Length: 241)
Name: NF9388A_low_223
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_223 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 117 - 226
Target Start/End: Original strand, 7177168 - 7177277
Alignment:
| Q |
117 |
tgcattgttattgcttgcagagaatggggtgtaataatgcaatatataaatcgagtcttttgttacatactaggagcataaatccaattattttacgata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
7177168 |
tgcattgttattgcttgcagagaatggggtgtaataatgcaatatataaatcgagtcttttgttacatactaggagcataaagccaattattttatgata |
7177267 |
T |
|
| Q |
217 |
ggactctttt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
7177268 |
tgactctttt |
7177277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 7177049 - 7177115
Alignment:
| Q |
1 |
gtggacatgcatttgttgctaaaccaatgtaaggttgttgtcctaggatgatggagatgttgctgac |
67 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177049 |
gtggacatgcatttgttgctaaaccaatataaggttgttgtcctaggatgatggagatgttgctgac |
7177115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University