View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_224 (Length: 241)
Name: NF9388A_low_224
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_224 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 241
Target Start/End: Complemental strand, 44826937 - 44826704
Alignment:
| Q |
7 |
acaatgagatggacatcaaagtcaaggtcgatgtcaagaaagagcaaatctaagaagttcaaatattcttcaaaatcttgtggacttccatccaaatgga |
106 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44826937 |
acaatgagatgc-catcaaagtcaaggtcgatgtcaagaaagagcaaatctaagaagttcaaatattcttcaaaatcttgtggacttccatccaaatgga |
44826839 |
T |
 |
| Q |
107 |
aaagaagaagaaataccgatgagaaaaacaaactggaaaagcactacacaccttgtgaatgtgagggggcgtgtggaaagcaatgtacatgtcgtcttaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44826838 |
aaagaagaagaaataccgatgagaaaaacaaactggaaaagcactatacaccttgtgaatgtgagggggcgtgtggaaagcaatgtccatgtcgtcttaa |
44826739 |
T |
 |
| Q |
207 |
tggttattgcggtgaaaaatattgtgggtatgtca |
241 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44826738 |
tggtttttgctgtgaaaaatattgtgggtatgtca |
44826704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University