View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_227 (Length: 239)
Name: NF9388A_low_227
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_227 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 10441129 - 10440906
Alignment:
| Q |
16 |
aaatgttagcagggattgaatcatggtcctccttcagggacttctttttcaaagatattgtcgaatatgactcatttactgataagtgggtaggtgctcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441129 |
aaatgttagcagggattgaatcatggtcctccttcagggacttctttttcaaagatattgtcgaatatgactcatttactgataagtgggtaggtgctcg |
10441030 |
T |
|
| Q |
116 |
agcatagcggagtggctgtactgtattatagtagttaaatactgcattgtagtatgcagccctaactattgcaattgcttctctttaggttttgactcat |
215 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441029 |
agcatagcggagtgactggactgtattatagtagttaaatactgcattgtagtatgcagccctaactattgcaattgcttctctttaggttttgactcat |
10440930 |
T |
|
| Q |
216 |
tacctttttgttagttaacacatt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10440929 |
tacctttttgttagttaacacatt |
10440906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University