View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_233 (Length: 238)
Name: NF9388A_low_233
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_233 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 32915363 - 32915157
Alignment:
| Q |
15 |
atatgaactagtaaagcaaaaccaatgaaatttcaaattataataggatcataaaaactgaaggcaacccaactcaccagaggttgcagtggtctcagga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
32915363 |
atatgaactagtaaagcaaaaccaatgaaatttcaaattataataggatcaaaaaaactgaaggcagcccaactcaccagaggttgcagtggcctcagga |
32915264 |
T |
|
| Q |
115 |
ggattccccatgaagtaaaggaaaaagtcaaaatcacaaatgtttgtaaaaaacctgtgtactttgtgaagagctacaaagcaagagaaggaaggatggt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32915263 |
ggattccccatgaagtaaaggaaaaagtcaaaatcacaaatgtatgtaaaaaacctgtgtactttgtgaagagctacaaagcaagagaaggaagggtggt |
32915164 |
T |
|
| Q |
215 |
ggtggtg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
32915163 |
ggtggtg |
32915157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University