View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_234 (Length: 238)
Name: NF9388A_low_234
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_234 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 17 - 169
Target Start/End: Complemental strand, 7617718 - 7617568
Alignment:
| Q |
17 |
atattagaaatcaatgatgcatgtaatttcaatgaatgtgtgaagcaaatagtgtgtgcttttataagcttctgttctgtctttaaagtgnnnnnnnnnc |
116 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7617718 |
atataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctgtctttaaagtg--aaaaaaac |
7617621 |
T |
|
| Q |
117 |
cggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617620 |
cggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
7617568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University