View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_253 (Length: 230)
Name: NF9388A_low_253
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_253 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 87 - 225
Target Start/End: Complemental strand, 24244792 - 24244654
Alignment:
| Q |
87 |
gacatttaagtcaatacaggtaggttaagcacaaacttgaatacctcaaaattcaaattgaagaaatgtacatacaataaacataaaattccaaggttta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24244792 |
gacatttaagtcaatacaggtaggttaagcacaaacttgaatacctccaaattcaaattgaagaaatgtacatacaataaacataaaattccaaggttta |
24244693 |
T |
 |
| Q |
187 |
ttaatttattgtcacagttgataaagtaaagaaaaacat |
225 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24244692 |
ttaatttattgtcacagttggtaaagtaaagaaaaacat |
24244654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University