View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9388A_low_255 (Length: 230)

Name: NF9388A_low_255
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9388A_low_255
NF9388A_low_255
[»] chr5 (1 HSPs)
chr5 (13-224)||(19252262-19252473)


Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 19252262 - 19252473
Alignment:
13 ttgcaaacttttatattgtagaataatacagagatgggactgaaattataattccgttgcgaagacttcaaaatcctttatgttgcgcctgtgattatgg 112  Q
    ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||    
19252262 ttgcaaacttttatattgtagaataatacggagatgcgactgaaattataattccgttgcgaagacttcaaaatcctttatgttgcgcttgaaattatgg 19252361  T
113 ttgtggaccgcactttaaaaccataaacgaagtaaaaataaacctcggtttgtgagcttcgagttgctatcctctccaaagattgtatctttctgcatgc 212  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19252362 ttgtggaccgcactttaaaaccatgaacgaagtaaaaataaacctcggtttgtgagcttcgagttgctatcctctccaaagattgtatctttctgcatgc 19252461  T
213 cacagtagttct 224  Q
    ||||||||||||    
19252462 cacagtagttct 19252473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University