View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_255 (Length: 230)
Name: NF9388A_low_255
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_255 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 19252262 - 19252473
Alignment:
| Q |
13 |
ttgcaaacttttatattgtagaataatacagagatgggactgaaattataattccgttgcgaagacttcaaaatcctttatgttgcgcctgtgattatgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
19252262 |
ttgcaaacttttatattgtagaataatacggagatgcgactgaaattataattccgttgcgaagacttcaaaatcctttatgttgcgcttgaaattatgg |
19252361 |
T |
 |
| Q |
113 |
ttgtggaccgcactttaaaaccataaacgaagtaaaaataaacctcggtttgtgagcttcgagttgctatcctctccaaagattgtatctttctgcatgc |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19252362 |
ttgtggaccgcactttaaaaccatgaacgaagtaaaaataaacctcggtttgtgagcttcgagttgctatcctctccaaagattgtatctttctgcatgc |
19252461 |
T |
 |
| Q |
213 |
cacagtagttct |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19252462 |
cacagtagttct |
19252473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University