View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_266 (Length: 230)
Name: NF9388A_low_266
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_266 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 3342347 - 3342124
Alignment:
| Q |
1 |
ttgataccacccactaacctgttagttaaataacacaaaagttcattaaaaatatgaataacgatgccaaaatttgatttgttctcagaaaacctattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342347 |
ttgataccacccactaacctgttagttaaataacacaaaagttcattaaaaatatgaataacaatgccaaaatttgatttgttctcagaaaacctattga |
3342248 |
T |
|
| Q |
101 |
atttatgataccttaattacctgcttttcattgtaccatggactccatggcttggtgattggcaaaccaagaagatttatgctgtatcttgttgacaata |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342247 |
atttatgatatcttaattacctgcttttcattgtaccatggactccatggcttggtgattggcaaaccaagaagatttatgctgtatcttgttgacaata |
3342148 |
T |
|
| Q |
201 |
ctggcactctaccatctgtgtctc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3342147 |
ctggcactctaccatctgtgtctc |
3342124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 224
Target Start/End: Complemental strand, 3334785 - 3334686
Alignment:
| Q |
125 |
ttttcattgtaccatggactccatggcttggtgattggcaaaccaagaagatttatgctgtatcttgttgacaatactggcactctaccatctgtgtctc |
224 |
Q |
| |
|
||||||| |||||| ||||||||| | ||||| || |||||| |||||| ||| ||||||||| ||||| | ||||||||||||||||| ||||||| |
|
|
| T |
3334785 |
ttttcatggtaccaaggactccattgtttggtaataggcaaatcaagaatgcttaagctgtatctggttgatagcactggcactctaccatcagtgtctc |
3334686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University