View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_275 (Length: 228)
Name: NF9388A_low_275
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_275 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4082857 - 4082634
Alignment:
| Q |
1 |
tttaatggttttgtttcttggcaaatgatgatcgaagggtgtctggggaattcaaattcctatagaaatatatatg--gttttgggaaatgatcaaatgg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4082857 |
tttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatagaaatatatatatagttttgggaaatgatcaaatgg |
4082758 |
T |
 |
| Q |
99 |
aaannnnnnnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtct |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082757 |
aaattttgttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtct |
4082658 |
T |
 |
| Q |
199 |
aaacttggaaaatttagttgatag |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4082657 |
aaacttggaaaatttagttgatag |
4082634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University