View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_280 (Length: 225)
Name: NF9388A_low_280
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_280 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 195
Target Start/End: Original strand, 47582470 - 47582642
Alignment:
| Q |
23 |
gaggtgtctttctttggtgtttgttaacttgcagagcctaagaaataggaatttggtgtcacatttagctttcttcagttccatgcataatacccattgg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582470 |
gaggtgtctttctttggtgtttgttaacttgcagagcctaagaaataggtatttggtgtcacatttagctttcttcagttccatgcataatacccattgg |
47582569 |
T |
|
| Q |
123 |
tttgttgtatggtcccatgccgggacaccatcttcttccggcaccacctatcatcaccttctttgaacatatt |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47582570 |
tttgttgtatggtcgcatgccgggacaccatcttcttccggcaccacctatcatcatcttctttgaacatatt |
47582642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University