View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_297 (Length: 212)
Name: NF9388A_low_297
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_297 |
 | |
|
| [»] scaffold0066 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0066 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 52 - 172
Target Start/End: Complemental strand, 33657 - 33537
Alignment:
| Q |
52 |
agaggtggctgtgacgcatattcggagacttttagacatcacggcatgcacctcagccttcaatggctccccaaaacccaaagagtatcagaatttggac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33657 |
agaggtggctgtgacgcatattcggagacttttagacatcacggcatgcacctcagccttcaatggctccccaaaacccaaagagtatcagaatttggac |
33558 |
T |
|
| Q |
152 |
aattctattacttcttttcat |
172 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
33557 |
aattctatgacttcttttcat |
33537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 22 - 134
Target Start/End: Complemental strand, 31330 - 31218
Alignment:
| Q |
22 |
ttgttatttttcagaggagtatgacacggaagaggtggctgtgacgcatattcggagacttttagacatcacggcatgcacctcagccttcaatggctcc |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31330 |
ttgttatttttcagaggagtacaacacggaagaggtggcggtgacgcatattcggagacttttagacatcacggcatgcacctcaaccttcaatggctcc |
31231 |
T |
|
| Q |
122 |
ccaaaacccaaag |
134 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31230 |
ccaaaacccaaag |
31218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 189
Target Start/End: Complemental strand, 31157 - 31114
Alignment:
| Q |
146 |
ttggacaattctattacttcttttcattttcccatcttacacct |
189 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
31157 |
ttggacaattctatgacttcttttcattttcccaccttacacct |
31114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University