View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9388A_low_299 (Length: 211)

Name: NF9388A_low_299
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9388A_low_299
NF9388A_low_299
[»] chr6 (1 HSPs)
chr6 (41-182)||(23333854-23333995)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 41 - 182
Target Start/End: Original strand, 23333854 - 23333995
Alignment:
41 attgatggaaaaggaacatgcttcagatagacaaccttactgtccgcttcatgagtcacacccaacttcaatggctgttttggttacagcctccgtgcct 140  Q
    |||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
23333854 attgatggaaaacgaagatgcttcagatagacaaccttattgtccgcttcatgagtcacacccaacttcaatggctgttttggttgcagcctccgtgcct 23333953  T
141 tgcaaagagcaccccacccacctccaatcttacacaccagcc 182  Q
    ||||||||||||||||||||||||||||||||||||||||||    
23333954 tgcaaagagcaccccacccacctccaatcttacacaccagcc 23333995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University