View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_315 (Length: 201)
Name: NF9388A_low_315
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_315 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 10 - 186
Target Start/End: Original strand, 26037170 - 26037351
Alignment:
| Q |
10 |
atgtccaagaatatgaagagcatcgaactcccttagtttgaaatc-----aaccaatatgcagacatttgcgacaggcacaccacaataacaatttaact |
104 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26037170 |
atgtcaaacaatatgaagagcatcaaactcccttagtttgaaaccaaccaaaccaatatgcaaacatttgcgacaggcacaccacaataacaatttaact |
26037269 |
T |
|
| Q |
105 |
cgaggaagaacttgcaaattccagataaagttccaagttggtgtgaagttggaaggaaattgacatggagatgtgtgatgtc |
186 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26037270 |
caaggaagaacttgcaaattccagataaagttccaagttggtgtgaagttggaaggaaattgacatggagatgtgtggtgtc |
26037351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University