View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_41 (Length: 383)
Name: NF9388A_low_41
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 11 - 376
Target Start/End: Original strand, 23118307 - 23118672
Alignment:
| Q |
11 |
acatagagggtgcagttggagaggaagcatcagaagaagatgagacatcaggcggattcatgttaaaaaccgaaggctggagaggatttgcggccagagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118307 |
acatagagggtgcagttggagaggaagcatcagaagaagatgagacatcaggcggattcatgttaaaaaccgaaggctggagaggatttgcggccagagg |
23118406 |
T |
 |
| Q |
111 |
aggcatgttgagaaggatgttaagcgcgcttgcttgccagttcctctgaatttgtaattcaagagtattgtaggccagatggttcatgatggcaatttga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118407 |
aggcatgttgagaaggatgttaagcgcgcttgcttgccagttcctctgaatttgtaattcaagagtattgtaggccagatggttcatgatggcaatttga |
23118506 |
T |
 |
| Q |
211 |
ttttcacacagcttacggatgtcatcccgagtcttgctcgtgttcttctcaattttagaacgttttggtggtatctcatccgtagggatggattgaggaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118507 |
ttttcacacagcttacggatgtcatcccgagtcttgctcgtgttcttctcaattttagaacgttttggtggtatctcatccgtagggatggattgaggaa |
23118606 |
T |
 |
| Q |
311 |
gacgtggaacaccatcagaaaagatatatggacaagtagactgaagagtcctaaaagatctcattg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118607 |
gacgtggaacaccatcagaaaagatatatgaacaagtagactgaagagtcctaaaagatctcattg |
23118672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University