View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_83 (Length: 318)
Name: NF9388A_low_83
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 9 - 312
Target Start/End: Original strand, 36125976 - 36126279
Alignment:
| Q |
9 |
tggtgtttagggatacttatattggagctattgacagggaagttccctgcaaattatttgaggcatgggaagggagcaaatgaagatttagcaatgtggg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125976 |
tggtgtttagggatacttatattggagctattgacagggaagttccctgcaaattatttgaggcatgggaagggagcaaatgaagatttagcaatgtggg |
36126075 |
T |
|
| Q |
109 |
tggaatctatagtgagggaagggtggagtggagaagtgttggataaaagcataggtggtgggagtagaggtgaagagggtgagatgttgaagctgttgag |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36126076 |
tggaatctatagtgagggatgggtggagtggagaagtgttggataaaagcataggtggtgggagtagaggtgaagaaggtgagatgttgaagctgttgag |
36126175 |
T |
|
| Q |
209 |
gattggaatgagttgttgtgaatggagtttggagaataggttgggttggaaggaggcagtggcaaagattgaggagttgaaggaaatggatcatgtgggg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126176 |
gattggaatgagttgttgtgaatggagtttggagaataggttgggttggaaggaggcagtggcaaagattgaggagttgaaggaaatggatcatgtgggg |
36126275 |
T |
|
| Q |
309 |
gttg |
312 |
Q |
| |
|
|||| |
|
|
| T |
36126276 |
gttg |
36126279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 1256079 - 1256129
Alignment:
| Q |
186 |
ggtgagatgttgaagctgttgaggattggaatgagttgttgtgaatggagt |
236 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1256079 |
ggtgagatgttgaagcttttgaggattggaatgtactgttgtgaatggagt |
1256129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University