View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388A_low_87 (Length: 314)
Name: NF9388A_low_87
Description: NF9388A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388A_low_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 6917720 - 6917429
Alignment:
| Q |
1 |
aaaaattacttatcacttaggccagcaacatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataagtctgtgcatttagcattt |
100 |
Q |
| |
|
|||||||||||||||||| | || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917720 |
aaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataagtctgtgcatttagcattt |
6917621 |
T |
 |
| Q |
101 |
tatattgagtgtgctcaaacaacaagcaaaaggaaaatcagaacctatatgtttcggaatcaacctcgccgcgctcaatcttgatggcctggaacttgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917620 |
tatattgagtgtgctcaaacaacaagcaaatggaaaatcagaacctatatgtttcgaaatcaacctcgccgcgctcaatcttgatggcctggaacttgcc |
6917521 |
T |
 |
| Q |
201 |
tttctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgtttcctgttgcagaactg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6917520 |
attctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgttccctgttgcagaactg |
6917429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University