View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_high_27 (Length: 269)
Name: NF9388_high_27
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 254
Target Start/End: Original strand, 48670610 - 48670857
Alignment:
| Q |
7 |
ttggtgttcttgtagtaaattgtagcatattcaatccaacaccatcattgtcagccatgattataaatcattataagatgaggggaaatattttgagtta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48670610 |
ttggtgttcttgtagtaaattgtagcatattcaatccaacaccatcattgtcagccatgattataaatcattataagatgaggggaaatattttgagtta |
48670709 |
T |
 |
| Q |
107 |
taatcttggtggtatgggttgtagtgctggaattattgctgttgatttggctagggatatacttcaatctaatcctggtaactatgctgttgttgtgagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48670710 |
taatcttggtggtatgggttgtagtgctggaattattgctgttgatttggctagggatatacttcaatctaatcctggtaactatgctgttgttgtgagt |
48670809 |
T |
 |
| Q |
207 |
accgaaatggttggatttaattggtatcaaggaaaagaaagatcaatg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48670810 |
accgaaatggttggatttaattggtatcaaggaaaagaaagatcaatg |
48670857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 39 - 136
Target Start/End: Original strand, 15237164 - 15237261
Alignment:
| Q |
39 |
aatccaacaccatcattgtcagccatgattataaatcattataagatgaggggaaatattttgagttataatcttggtggtatgggttgtagtgctgg |
136 |
Q |
| |
|
|||||||||||||| | || ||||||||| | |||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15237164 |
aatccaacaccatctctttctgccatgattgtgaatcattataagttgagaggaaatatcttgagttataatcttggtggtatgggttgtagtgctgg |
15237261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 142
Target Start/End: Original strand, 34052056 - 34052096
Alignment:
| Q |
102 |
agttataatcttggtggtatgggttgtagtgctggaattat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34052056 |
agttataatcttggtggtatgggttgtagtgctggacttat |
34052096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 10277401 - 10277483
Alignment:
| Q |
72 |
aatcattataagatgaggggaaatattttgagttataatcttggtggtatgggttgtagtgctggaattattgctgttgattt |
154 |
Q |
| |
|
||||||||||| | || ||||||||||||| ||||||||| |||||||||| || |||||||| ||||||| || ||||| |
|
|
| T |
10277401 |
aatcattataaacttagaggaaatattttgatctataatcttagtggtatgggatgcagtgctggtgttattgcggtggattt |
10277483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University