View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_106 (Length: 227)
Name: NF9388_low_106
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_106 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 9439654 - 9439510
Alignment:
| Q |
1 |
aagtatttggatagtaagaaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439654 |
aagtatttggatagtaagcaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcct |
9439555 |
T |
 |
| Q |
101 |
cttccactctcccactttcttcttataatttttgcgaattccctc |
145 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
9439554 |
cttccactctcccactttcttcatataattcttgcgaattccctc |
9439510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 184 - 227
Target Start/End: Complemental strand, 9439512 - 9439469
Alignment:
| Q |
184 |
ctccgagggaatatctggtctaaaattcttttcaggcgaacctt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439512 |
ctccgagggaatatctggtctaaaattcttttcaggcgaacctt |
9439469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University