View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_114 (Length: 217)
Name: NF9388_low_114
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_114 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
| [»] scaffold0061 (1 HSPs) |
| | |
|
| [»] scaffold0017 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 43310759 - 43310573
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtg |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
43310759 |
ggtggtgtcggaggcgggtggtttcaggagggtgtgtctcgtttggtgggagacgggg-atgatacccttttttggcatgattcgtggttaagtggtgtg |
43310661 |
T |
|
| Q |
117 |
ccgtttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctgcttggtgcgagg |
204 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43310660 |
ccgtttagtgtgcgctttaggcgcctttttgatcttgcggttgataaatcttgtacggttgcttccatgttttctgctgggtgggagg |
43310573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 26146715 - 26146541
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgataccctttttt-ggcatgattcgtgattaggtggtgt |
115 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
26146715 |
ggtggtgtcagaggcgggtggtttcaggagggtgtgtctcgtttg-tgggagatgagg-atgataccctttttttggcatgatttgtggttaggtggtgt |
26146618 |
T |
|
| Q |
116 |
gccgtttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctg |
192 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26146617 |
gccgtttagtgtgcgctttaggcgcctttttgatcttgcggttgataaatcttgtacggttgcttccatgttttctg |
26146541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 43 - 192
Target Start/End: Complemental strand, 10689035 - 10688887
Alignment:
| Q |
43 |
ggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtgccgtttagtgtgcgctttaagcgnnn |
142 |
Q |
| |
|
|||| ||| |||||||| |||||| ||||||| ||||||| ||||||||| ||||| |||| |||||||||||||||||| |||||||||||| ||| |
|
|
| T |
10689035 |
ggagtgtgcgtctcgttcggtgggggatgggg-atgatactcttttttggtatgatccgtggttaggtggtgtgccgttttgtgtgcgctttaggcgcct |
10688937 |
T |
|
| Q |
143 |
nnnngatctcacggttgataaatcttgtacggttgcttccatgttttctg |
192 |
Q |
| |
|
|| || |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10688936 |
ttttgaccttgcggttgataaatcttgtacggttgctgacatgttttctg |
10688887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 21 - 204
Target Start/End: Complemental strand, 28277 - 28096
Alignment:
| Q |
21 |
gtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtgccgt |
120 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||| | |
|
|
| T |
28277 |
gtgtcggaggcggctggtttcaggagggtgtgtctcgtttggtgggagat-ggggatgataccc-tttttggcatgattcgtggttaggtggtgtgccat |
28180 |
T |
|
| Q |
121 |
ttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctgcttggtgcgagg |
204 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
28179 |
ttagtgtgcgctttaggcgccttttttatcttgcggttgataaatcttgtacggttgcttccatgttttctgctgggtgggagg |
28096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 64279 - 64453
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtg |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
64279 |
ggtggtgtcggaggcgggtggtttcaggagggtgtgtctcgtttggtggaagat-ggggatgatacccttttttgacatgatccgtggttaggtggtgtg |
64377 |
T |
|
| Q |
117 |
ccgtttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctg |
192 |
Q |
| |
|
| |||| |||||||||||| ||| ||||| |||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
64378 |
ctgtttcgtgtgcgctttaggcgcctttttgatcttgcggttgataaatcttgcatggttgcttacatgttttctg |
64453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 134353 - 134179
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtg |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
134353 |
ggtggtgtcggaggcgggtggtttcaggagggtgtgtctcgtttggtggaagat-ggggatgatacccttttttgacatgatccgtggttaggtggtgtg |
134255 |
T |
|
| Q |
117 |
ccgtttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctg |
192 |
Q |
| |
|
| |||| |||||||||||| ||| ||||| |||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
134254 |
ctgtttcgtgtgcgctttaggcgcctttttgatcttgcggttgataaatcttgcatggttgcttacatgttttctg |
134179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 52250764 - 52250938
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtg |
116 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
52250764 |
ggtggtgtcggtggcgggtggtttcaggagggtgtgtctcatttggtgggagacgggg-atgatacccttttttggcatgattcgtggttaggtggtata |
52250862 |
T |
|
| Q |
117 |
ccgtttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctg |
192 |
Q |
| |
|
|| ||| |||||||||||| ||| ||||| |||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
52250863 |
ccttttcgtgtgcgctttaggcgcctttttgatcttgcggttgataaatcttgcacggttgcttacatgttttctg |
52250938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 33 - 191
Target Start/End: Complemental strand, 7163984 - 7163827
Alignment:
| Q |
33 |
ggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtgccgtttagtgtgcgct |
132 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| ||||| || | ||||| | |||||||||||| |||| |||||||||||||||||| ||||||| | |
|
|
| T |
7163984 |
ggtggtttcaagaaggtgtgtctcgtttggtggaagatgcggca-gatactttattttggcatgatccgtggttaggtggtgtgccgttttgtgtgcgat |
7163886 |
T |
|
| Q |
133 |
ttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttct |
191 |
Q |
| |
|
| | || ||||| |||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
7163885 |
tcaggcacctttttgatcttgcggttgataaatctagtacggttgcgtccatgtattct |
7163827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 25018958 - 25019075
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtg |
116 |
Q |
| |
|
|||||||| || ||| ||||||| | |||||||||||||||| |||||| ||||||| |||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
25018958 |
ggtggtgttggtggcgggtggttccgagagggtgtgtctcgttcggtgggggatggggt-tgatactcttttttggcatgatccgtggttaggtggtgtg |
25019056 |
T |
|
| Q |
117 |
ccgtttagtgtgcgcttta |
135 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
25019057 |
ccgttttgtgtgcgcttta |
25019075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 41805383 - 41805569
Alignment:
| Q |
17 |
ggtggtgtcggaggcaggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtg |
116 |
Q |
| |
|
|||||||| || ||| ||||||| | ||| |||||||| ||| |||||| ||||| ||| ||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
41805383 |
ggtggtgttggtggcgggtggttccgagagtgtgtgtctagttcggtgggggatggtgga-gatactcttttttggcatgatccgtggttaggtggtgtg |
41805481 |
T |
|
| Q |
117 |
ccgtttagtgtgcgctttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctgcttggtgcgagg |
204 |
Q |
| |
|
|||||| |||||||||||| ||| || || ||||||||||||| |||||||||||| |||||||| |||| |||| |||| |
|
|
| T |
41805482 |
ccgttttgtgtgcgctttaggcgcctttttgaccttgcggttgataaatcgtgtacggttgctgacatgttttatgctgggtgggagg |
41805569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 25019095 - 25019143
Alignment:
| Q |
156 |
gttgataaatcttgtacggttgcttccatgttttctgcttggtgcgagg |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |||| |||| |
|
|
| T |
25019095 |
gttgataaatcttgtacggttgctgacatgttttatgctgggtgggagg |
25019143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 33 - 204
Target Start/End: Complemental strand, 12332339 - 12332169
Alignment:
| Q |
33 |
ggtggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtgccgtttagtgtgcgct |
132 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||| ||||| ||| ||||| ||||||||||||||| |||| ||||||| || |||||| ||| ||||| |
|
|
| T |
12332339 |
ggtggtttcgagagtgtgtgtctcgtacggtgggggatggtgga-gatacacttttttggcatgatccgtggttaggtgacgtaccgttttgtgagcgct |
12332241 |
T |
|
| Q |
133 |
ttaagcgnnnnnnngatctcacggttgataaatcttgtacggttgcttccatgttttctgcttggtgcgagg |
204 |
Q |
| |
|
||| || ||||| ||||||||||||| |||||||| || |||||||||||||| |||| |||| |
|
|
| T |
12332240 |
ttaggcacctttttgatcttgcggttgataaatcgtgtacggtggccgccatgttttctgctgggtgggagg |
12332169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 34434746 - 34434643
Alignment:
| Q |
35 |
tggtttcaggagggtgtgtctcgtttggtgggagatgggggatgatacccttttttggcatgattcgtgattaggtggtgtgccgtttagtgtgcgcttt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| | ||||| | ||||||| ||| ||| | |||| |||||||||| |||||||||| |
|
|
| T |
34434746 |
tggtttcaggagggtgtgtctcgtttggtgggagacggggta-gatactttattttggcgcgatgtgtgggttggtgatgtgccgttttgtgtgcgcttc |
34434648 |
T |
|
| Q |
135 |
aagcg |
139 |
Q |
| |
|
||||| |
|
|
| T |
34434647 |
aagcg |
34434643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 6994755 - 6994805
Alignment:
| Q |
154 |
cggttgataaatcttgtacggttgcttccatgttttctgcttggtgcgagg |
204 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| |||| |||| |
|
|
| T |
6994755 |
cggttgataaatcttgtacggttgcatacatgttttctgctgggtgggagg |
6994805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University