View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_115 (Length: 214)
Name: NF9388_low_115
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_115 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 125 - 198
Target Start/End: Original strand, 7347602 - 7347675
Alignment:
| Q |
125 |
ctagtttgaaaacctgaacccaactaatactatgaatatatcagatggttaaacctctcatacaatgagaaact |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7347602 |
ctagtttgaaaacctgaacccaactaatactatgaatatatcagatggttaaacctctcatacaatgacaaact |
7347675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 63
Target Start/End: Original strand, 7347574 - 7347604
Alignment:
| Q |
33 |
atgaatcaaaataaaagtcagattaaaccta |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7347574 |
atgaatcaaaataaaagtcagattaaaccta |
7347604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University