View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_118 (Length: 204)
Name: NF9388_low_118
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_118 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 12400797 - 12400969
Alignment:
| Q |
19 |
aattttgataggttccaatgagtccacgttcatatatgacaccaagagtattgatttcagcctcaacaggaacaatgttcatgacccaaacaggatcatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12400797 |
aattttgataggttccaatgagtccacgttcatatatgacaccaagagtattgatttcagcctcaacaggaacaatgttcatgacccaaacaggatcatc |
12400896 |
T |
 |
| Q |
119 |
aactagtgcagctgcaaagcctcccaagtaagaattcatatcaagaagatttctatatcttccagtctctgct |
191 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12400897 |
aaccagtgcagctgcaaagcctcccaagtaagaattcatatcaagaagatttctatatcttccagtctctgct |
12400969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 24 - 163
Target Start/End: Original strand, 28638488 - 28638627
Alignment:
| Q |
24 |
tgataggttccaatgagtccacgttcatatatgacaccaagagtattgatttcagcctcaacaggaacaatgttcatgacccaaacaggatcatcaacta |
123 |
Q |
| |
|
||||| ||||| || | ||| |||||||| | ||||||||| || ||||| |||||||| || ||||||| |||||||||||||| |||||||||| | |
|
|
| T |
28638488 |
tgatatgttccgatcaatccgcgttcataaacgacaccaagtgtgttgatctcagcctcgaccggaacaacattcatgacccaaactggatcatcaatca |
28638587 |
T |
 |
| Q |
124 |
gtgcagctgcaaagcctcccaagtaagaattcatatcaag |
163 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
28638588 |
ttgcagctgcaaatcctcccaagtaagcattcatatcaag |
28638627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University