View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_32 (Length: 356)
Name: NF9388_low_32
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 9439468 - 9439131
Alignment:
| Q |
1 |
catcaaattctcattgtatatatctcattcatggctctatcagcatgtcccaaacaagacttattttgtctgcaaggttgaaattggcaagatatagtgt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439468 |
catcaaattctcattgtatagatctcattcatggctctatcagcatgtcccaaacaagacttattttgtctgcaaggttgaaattggcaagatatagtgt |
9439369 |
T |
|
| Q |
101 |
tcccatgattcttcttgttcggggagacattcctagtgaacctttcctggctgaactcactggagtcattatgaatggattgaaggacgaggtgaaagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9439368 |
tcccatgattcttcttgttcggggagacattcctagtgaacctttcctggctgaactcactggagtcagtatgaatggattgaaggacgaggtgaaagtt |
9439269 |
T |
|
| Q |
201 |
gaacgtaagtgctgggtcgatttccattcctatagagcccaaaaatgttatgttgtcaacctgatttaggtttcagctgacagcctgacactgatactac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439268 |
gaacgtaagtgctgggtcgatttccattcctatagagcccaaaaatgttatgttgtcaacctgatttaggtttcagctgacagcctgacactgatactac |
9439169 |
T |
|
| Q |
301 |
tactttttcaattgctgatgactgataacgacgcagtt |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439168 |
tactttttcaattgctgatgactgataacgacgcagtt |
9439131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University