View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_47 (Length: 320)
Name: NF9388_low_47
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 6 - 317
Target Start/End: Original strand, 2892280 - 2892591
Alignment:
| Q |
6 |
gtttgggggtgtaccaattgttttacactctagtgtcccattgcaatcaccggtttgacactttccgagacctgaattgtcgaaagtgcaattggttcga |
105 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892280 |
gtttggtggcgtaccaattgttttacactctagtgtcccattgcaatcaccggtttgacactttccgagacctgaattgtcgaaagtgcaattggttcga |
2892379 |
T |
 |
| Q |
106 |
ccccagattcttgcgttacttgtaccgttggttatgttcatgttccatgattcaccggtgttgagtttcatgccaccaccggggaaggctgcagcccata |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2892380 |
ccccagattcttgcgttacttgtaccgttggttatgttcatgttccatgattcaccggtgttgagtttcatgccgccaccggggaaggctgcagcccata |
2892479 |
T |
 |
| Q |
206 |
cggtgtagttgcatttgtttgtgatattgaatcttcctgcttgtgctgcagctatggatgttatggctatgagaaggaagattgagagatttgttttcat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892480 |
cggtgtagttgcatttgtttgtgatattgaatcttcctgcttgtgctgcagctatggatgttatggctatgagaaggaagattgagagatttgttttcat |
2892579 |
T |
 |
| Q |
306 |
gatgatgtccat |
317 |
Q |
| |
|
||||||| |||| |
|
|
| T |
2892580 |
gatgatggccat |
2892591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University