View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_59 (Length: 293)
Name: NF9388_low_59
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 38278256 - 38277993
Alignment:
| Q |
1 |
ttaaggtggcggagatggtggtgagtttggttttgatgggtgggagtgatttgggtgtggaggtgggagttatgagtgttggtgaagccatgattgtgtt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278256 |
ttaaggtggaggagatggtggtgagtttggttttgatgggtgggagtgatttgggtgtggaggtgggagttatgagtgttggtgaagccatgattgtgtt |
38278157 |
T |
|
| Q |
101 |
gagagagagtaggagagattttgtgttatggtgatatgagaggaagatgtattggttttttgccacatggccttatcgtcttatctttgattttggtttt |
200 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278156 |
gagagagag--------agtttgtgttatggtgatatgagaggaagatgtattggttttttgccacatggccttatcgtcttatctttgattttggtttt |
38278065 |
T |
|
| Q |
201 |
tggatgagaaagcaaccaatggtttctaaggtatagatccatatgttgtgtcatcatagaattccaattatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38278064 |
tggatgagaaagcaaccaatggtttctaaggtatagatccatgtgttgtgtcatcatagaattccaattatg |
38277993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University