View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_61 (Length: 289)
Name: NF9388_low_61
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 9 - 111
Target Start/End: Complemental strand, 37074661 - 37074559
Alignment:
| Q |
9 |
taattctgcagcaacaaaaatttattttaaagtgagatgattttgaaaaattgattcttactaacaatggattgaagataaaatcatttgtgtttgcata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37074661 |
taattctgcagcaacaaaaatttattttaaagtgagatgattttgaaaaattgattcttactaacaatggattgaagataaaatcatttgtgtttgcata |
37074562 |
T |
 |
| Q |
109 |
tgg |
111 |
Q |
| |
|
||| |
|
|
| T |
37074561 |
tgg |
37074559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 167 - 273
Target Start/End: Complemental strand, 37074507 - 37074401
Alignment:
| Q |
167 |
acatatcatagttttaataagaatcaaatcattgttaatttgtttcatatattcactctaattgtattatatcttgtgatcgtggacagggtttgttctg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37074507 |
acatatcatagttttaataagaatcaaatcatggttaatttatttcatatattcactctaattgtattatatcttgtgatcgtggacagggtttgttctg |
37074408 |
T |
 |
| Q |
267 |
ttcctct |
273 |
Q |
| |
|
||||||| |
|
|
| T |
37074407 |
ttcctct |
37074401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University