View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9388_low_87 (Length: 246)

Name: NF9388_low_87
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9388_low_87
NF9388_low_87
[»] chr5 (1 HSPs)
chr5 (1-175)||(2693345-2693511)


Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 2693511 - 2693345
Alignment:
1 catgtacttcttcagcctgacctgcataaaaattaatacatgtcctacttaacttagtcttagtgtactgaaattatatagttaaaaatgtaacaccgag 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||    
2693511 catgtacttctttagcctgacctgcataaaaattaatacatgtcctacttaacttagtcttagtgtactgaaattatatggttagaaatgtaacactgag 2693412  T
101 actttcggcatttcagattggatgtgtcaatgtgtgtcaagtgtctgacacatattggtgtcgacattgaacatt 175  Q
    |||||||| ||||||||||||||        |||||  ||||||| ||||||||||||||| |||||||||||||    
2693411 actttcggtatttcagattggat--------gtgtgcaaagtgtccgacacatattggtgttgacattgaacatt 2693345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University