View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_89 (Length: 246)
Name: NF9388_low_89
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 2693511 - 2693345
Alignment:
| Q |
1 |
catgtacttcttcagcctgacctgcataaaaattaatacatgtcctacttaacttagtcttagtgtactgaaattatatagttaaaaatgtaacaccgag |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |
|
|
| T |
2693511 |
catgtacttctttagcctgacctgcataaaaattaatacatgtcctacttaacttagtcttagtgtactgaaattatatggttagaaatgtaacactgag |
2693412 |
T |
|
| Q |
101 |
actttcggcatttcagattggatgtgtcaatgtgtgtcaagtgtctgacacatattggtgtcgacattgaacatt |
175 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
2693411 |
actttcggtatttcagattggat--------gtgtgcaaagtgtccgacacatattggtgttgacattgaacatt |
2693345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University