View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9388_low_93 (Length: 237)
Name: NF9388_low_93
Description: NF9388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9388_low_93 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 26043123 - 26043350
Alignment:
| Q |
1 |
ccaacagacgcaaaatccgtgaaggtaaaaatagcattgcaacttgagacaatgataatgatgtttgaaagagaaccagcacttctt----tgtattggt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
26043123 |
ccaacagacgcaaaatccgtgaaggtaaaaatagcattgcaacttgagacaatgataatgatgtttgaaagagaaccagcacttcttatattatattggt |
26043222 |
T |
|
| Q |
97 |
ggatgttcattgaaaatgccaaacaggacctatcacaaaaatatctttcatgctttgaatgcaactattaacttgtttttacatgtgactagatgatgga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26043223 |
ggatgttcattgaaaatgccaaacaggacctatcacaaaaatatctttcatgctttgaatgcaactattaacttgttcttacatgtgactagatgatgga |
26043322 |
T |
|
| Q |
197 |
accgttacgttacatgaatgagatatat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26043323 |
accgttacgttacatgaatgagatatat |
26043350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University